Review



htert rpe1 cells  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC htert rpe1 cells
    Htert Rpe1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 2180 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pmc13095346-34-14-16?v=ATCC
    Average 99 stars, based on 2180 article reviews
    htert rpe1 cells - by Bioz Stars, 2026-07
    99/100 stars

    Images



    Similar Products

    99
    ATCC htert rpe1 cells
    Htert Rpe1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pmc13095346-34-14-16?v=ATCC
    Average 99 stars, based on 1 article reviews
    htert rpe1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC cell culture
    Cell Culture, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pm42140944-314-0-15?v=ATCC
    Average 99 stars, based on 1 article reviews
    cell culture - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC human htert rpe 1 cells
    a.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells. Colors shown in the key and dotted lines denote gating used for analysis throughout this publication. b.) Scatterplot of DNA content versus median cyclin B1 intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. c.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. d.) Quantification of mean cyclin B1 intensity in MCF10A cells with non-targeting or cyclin B1 knockdowns to demonstrate cyclin B1 antibody specificity. A Mann-Whitney test was conducted to assess significance. Error bars are representative of 10-90 percentile range. P value: <0.0001. e.) Quantification of median cyclin B1 cytoplasmic intensity across the cell cycle <t>from</t> <t>RPE-1</t> cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. f.) Quantification of integrated SLBP intensity in MCF10A cells with non-targeting or SLBP knockdowns to demonstrate SLBP antibody specificity. Error bars are representative of 10-90 percentile range. A Mann-Whitney test was conducted to assess significance. P value: <0.0001. g.) Breakdown of quantification of median SLBP nuclear intensity across the cell cycle from into individual graphs. Data are presented as mean ± SEM. h.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 5μM RO-3306, or a combination of 5μM AZD6738 and 5μM RO-3306 for 1hr (n=3 biological replicates). Data are presented as mean ± SEM. i.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 1μM NU6140, or a combination of 5μM AZD6738 and 1μM NU6140 for 1hrs (n=3 biological replicates). Data are presented as mean ± SEM.
    Human Htert Rpe 1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/bio_rxiv__64898__2026__05__07__723638-155-0-4?v=ATCC
    Average 99 stars, based on 1 article reviews
    human htert rpe 1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC htert rpe1 human epithelial cells
    a.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells. Colors shown in the key and dotted lines denote gating used for analysis throughout this publication. b.) Scatterplot of DNA content versus median cyclin B1 intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. c.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. d.) Quantification of mean cyclin B1 intensity in MCF10A cells with non-targeting or cyclin B1 knockdowns to demonstrate cyclin B1 antibody specificity. A Mann-Whitney test was conducted to assess significance. Error bars are representative of 10-90 percentile range. P value: <0.0001. e.) Quantification of median cyclin B1 cytoplasmic intensity across the cell cycle <t>from</t> <t>RPE-1</t> cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. f.) Quantification of integrated SLBP intensity in MCF10A cells with non-targeting or SLBP knockdowns to demonstrate SLBP antibody specificity. Error bars are representative of 10-90 percentile range. A Mann-Whitney test was conducted to assess significance. P value: <0.0001. g.) Breakdown of quantification of median SLBP nuclear intensity across the cell cycle from into individual graphs. Data are presented as mean ± SEM. h.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 5μM RO-3306, or a combination of 5μM AZD6738 and 5μM RO-3306 for 1hr (n=3 biological replicates). Data are presented as mean ± SEM. i.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 1μM NU6140, or a combination of 5μM AZD6738 and 1μM NU6140 for 1hrs (n=3 biological replicates). Data are presented as mean ± SEM.
    Htert Rpe1 Human Epithelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/bio_rxiv__64898__2026__04__30__721698-275-0-19?v=ATCC
    Average 99 stars, based on 1 article reviews
    htert rpe1 human epithelial cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC htert rpe 1 cells
    a.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells. Colors shown in the key and dotted lines denote gating used for analysis throughout this publication. b.) Scatterplot of DNA content versus median cyclin B1 intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. c.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. d.) Quantification of mean cyclin B1 intensity in MCF10A cells with non-targeting or cyclin B1 knockdowns to demonstrate cyclin B1 antibody specificity. A Mann-Whitney test was conducted to assess significance. Error bars are representative of 10-90 percentile range. P value: <0.0001. e.) Quantification of median cyclin B1 cytoplasmic intensity across the cell cycle <t>from</t> <t>RPE-1</t> cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. f.) Quantification of integrated SLBP intensity in MCF10A cells with non-targeting or SLBP knockdowns to demonstrate SLBP antibody specificity. Error bars are representative of 10-90 percentile range. A Mann-Whitney test was conducted to assess significance. P value: <0.0001. g.) Breakdown of quantification of median SLBP nuclear intensity across the cell cycle from into individual graphs. Data are presented as mean ± SEM. h.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 5μM RO-3306, or a combination of 5μM AZD6738 and 5μM RO-3306 for 1hr (n=3 biological replicates). Data are presented as mean ± SEM. i.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 1μM NU6140, or a combination of 5μM AZD6738 and 1μM NU6140 for 1hrs (n=3 biological replicates). Data are presented as mean ± SEM.
    Htert Rpe 1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pm42034834-112-0-6?v=ATCC
    Average 99 stars, based on 1 article reviews
    htert rpe 1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC human rpe 1 cells
    CERKL deficiency leads to lipid accumulation and PC reduction <t>in</t> <t>RPE-1</t> cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.
    Human Rpe 1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pmc13109895-63-0-3?v=ATCC
    Average 99 stars, based on 1 article reviews
    human rpe 1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC epithelial rpe1 cells
    CERKL deficiency leads to lipid accumulation and PC reduction <t>in</t> <t>RPE-1</t> cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.
    Epithelial Rpe1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pm42015299-77-23-26?v=ATCC
    Average 99 stars, based on 1 article reviews
    epithelial rpe1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC cell culture htert rpe 1 cells
    CERKL deficiency leads to lipid accumulation and PC reduction <t>in</t> <t>RPE-1</t> cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.
    Cell Culture Htert Rpe 1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pm42018681-36-0-8?v=ATCC
    Average 99 stars, based on 1 article reviews
    cell culture htert rpe 1 cells - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    99
    ATCC rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag
    CERKL deficiency leads to lipid accumulation and PC reduction <t>in</t> <t>RPE-1</t> cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.
    Rpe 1 Cells Atcc Crl 4000 Oligonucleotides Grna1 Ninein Gctcagcccaaatatgttag, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rpe+crl+4000+cells/pm42019505-253-226-228?v=ATCC
    Average 99 stars, based on 1 article reviews
    rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag - by Bioz Stars, 2026-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    a.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells. Colors shown in the key and dotted lines denote gating used for analysis throughout this publication. b.) Scatterplot of DNA content versus median cyclin B1 intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. c.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. d.) Quantification of mean cyclin B1 intensity in MCF10A cells with non-targeting or cyclin B1 knockdowns to demonstrate cyclin B1 antibody specificity. A Mann-Whitney test was conducted to assess significance. Error bars are representative of 10-90 percentile range. P value: <0.0001. e.) Quantification of median cyclin B1 cytoplasmic intensity across the cell cycle from RPE-1 cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. f.) Quantification of integrated SLBP intensity in MCF10A cells with non-targeting or SLBP knockdowns to demonstrate SLBP antibody specificity. Error bars are representative of 10-90 percentile range. A Mann-Whitney test was conducted to assess significance. P value: <0.0001. g.) Breakdown of quantification of median SLBP nuclear intensity across the cell cycle from into individual graphs. Data are presented as mean ± SEM. h.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 5μM RO-3306, or a combination of 5μM AZD6738 and 5μM RO-3306 for 1hr (n=3 biological replicates). Data are presented as mean ± SEM. i.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 1μM NU6140, or a combination of 5μM AZD6738 and 1μM NU6140 for 1hrs (n=3 biological replicates). Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: ATR enforcement of the S/G2 checkpoint prevents premature S phase shutdown and genome instability

    doi: 10.64898/2026.05.07.723638

    Figure Lengend Snippet: a.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells. Colors shown in the key and dotted lines denote gating used for analysis throughout this publication. b.) Scatterplot of DNA content versus median cyclin B1 intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. c.) Scatterplot of DNA content versus mean EdU intensity in MCF10A cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs. Colors shown in the key and dotted lines denote cyclin B1 gating used for analysis throughout this article. d.) Quantification of mean cyclin B1 intensity in MCF10A cells with non-targeting or cyclin B1 knockdowns to demonstrate cyclin B1 antibody specificity. A Mann-Whitney test was conducted to assess significance. Error bars are representative of 10-90 percentile range. P value: <0.0001. e.) Quantification of median cyclin B1 cytoplasmic intensity across the cell cycle from RPE-1 cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. f.) Quantification of integrated SLBP intensity in MCF10A cells with non-targeting or SLBP knockdowns to demonstrate SLBP antibody specificity. Error bars are representative of 10-90 percentile range. A Mann-Whitney test was conducted to assess significance. P value: <0.0001. g.) Breakdown of quantification of median SLBP nuclear intensity across the cell cycle from into individual graphs. Data are presented as mean ± SEM. h.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 5μM RO-3306, or a combination of 5μM AZD6738 and 5μM RO-3306 for 1hr (n=3 biological replicates). Data are presented as mean ± SEM. i.) Quantification of median SLBP nuclear intensity across the cell cycle from MCF10A cells treated with DMSO, 5μM AZD6738, 1μM NU6140, or a combination of 5μM AZD6738 and 1μM NU6140 for 1hrs (n=3 biological replicates). Data are presented as mean ± SEM.

    Article Snippet: Human hTERT RPE-1 cells (ATCC, CRL-4000) were grown in DMEM/F12 medium supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, A5256801), 100U/mL penicillin/streptomycin, and 10μg/mL hygromycin B (Roche, 10843555001).

    Techniques: MANN-WHITNEY

    a.) Quantification of median cyclin B1 cytoplasmic intensity in RPE-1 cells with low or high yH2AX across the cell cycle. Cells were treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. b.) Quantification of mean yH2AX nuclear intensities across the cell cycle from control and cyclin B1 knockdown RPE-1 cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. c.) Quantification of mean yH2AX nuclear intensity across the cell cycle from MCF10A cells treated with DMSO + DMSO, DMSO + 5μM AZD6738, DMSO + 2μM LY2603618, 5μM KU60019 + DMSO, 5μM KU60019 + 5μM AZD6738, 5μM KU60019 + or 2μM LY2603618 + 5μM KU60019 for 7hrs (n=3 biological replicates). Data are presented as mean ± SEM. d.) Quantification of mean yH2AX nuclear intensity across the cell cycle from MCF10A cells treated with DMSO + DMSO, DMSO + 5μM AZD6738, DMSO + 2μM LY2603618, 5μM KU60019 + DMSO, 5μM NU7441 + 5μM AZD6738, 5μM NU7441 + or 2μM LY2603618 + 5μM NU7441 for 7hrs (n=3 biological replicates). Data are presented as mean ± SEM. e.) Representative images of cells undergoing normal mitosis versus mitotic failure. Scale bar is equal to 15μm.

    Journal: bioRxiv

    Article Title: ATR enforcement of the S/G2 checkpoint prevents premature S phase shutdown and genome instability

    doi: 10.64898/2026.05.07.723638

    Figure Lengend Snippet: a.) Quantification of median cyclin B1 cytoplasmic intensity in RPE-1 cells with low or high yH2AX across the cell cycle. Cells were treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. b.) Quantification of mean yH2AX nuclear intensities across the cell cycle from control and cyclin B1 knockdown RPE-1 cells treated with DMSO, 5μM AZD6738, or 2μM LY2603618 for 16hrs (n=3 biological replicates). Data are presented as mean ± SEM. c.) Quantification of mean yH2AX nuclear intensity across the cell cycle from MCF10A cells treated with DMSO + DMSO, DMSO + 5μM AZD6738, DMSO + 2μM LY2603618, 5μM KU60019 + DMSO, 5μM KU60019 + 5μM AZD6738, 5μM KU60019 + or 2μM LY2603618 + 5μM KU60019 for 7hrs (n=3 biological replicates). Data are presented as mean ± SEM. d.) Quantification of mean yH2AX nuclear intensity across the cell cycle from MCF10A cells treated with DMSO + DMSO, DMSO + 5μM AZD6738, DMSO + 2μM LY2603618, 5μM KU60019 + DMSO, 5μM NU7441 + 5μM AZD6738, 5μM NU7441 + or 2μM LY2603618 + 5μM NU7441 for 7hrs (n=3 biological replicates). Data are presented as mean ± SEM. e.) Representative images of cells undergoing normal mitosis versus mitotic failure. Scale bar is equal to 15μm.

    Article Snippet: Human hTERT RPE-1 cells (ATCC, CRL-4000) were grown in DMEM/F12 medium supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, A5256801), 100U/mL penicillin/streptomycin, and 10μg/mL hygromycin B (Roche, 10843555001).

    Techniques: Control, Knockdown

    CERKL deficiency leads to lipid accumulation and PC reduction in RPE-1 cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: PCYT1A Hypophosphorylation Underlies Retinal Lipid Dysregulation in CERKL Retinitis Pigmentosa and Is Therapeutically Reversed by Phosphatidylcholine

    doi: 10.1167/iovs.67.4.54

    Figure Lengend Snippet: CERKL deficiency leads to lipid accumulation and PC reduction in RPE-1 cells. ( A ) Western blot analysis of CERKL expression in the RPE-1 cells after siRNA knockdown for 72 hours. ( B ) Quantitative analysis of the Western blot data. At least three independent experiments were performed and quantified. The results are shown as mean ± SD. ***, P < 0.001. ( C ) Real-time PCR analysis of CERKL mRNA expression in RPE-1 cells after siRNA knockdown for 72 hours. ***, P < 0.001. ( D ) BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with si CERKL and its corresponding control followed by OA or BSA treatment. Scale bars = 10 µm. ( E ) BODIPY staining density per cell number as quantified by ImageJ software ( n = 6 fields/group). ( F ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with or without CERKL-GFP overexpression. Scale bars = 10 µm. ( G ) Nile red staining density per cell of vectors overexpression as quantified by ImageJ software. At least 30 cells were calculated from three independent experiments. ( H ) The triglyceride levels in NC and si CERKL groups. **, P < 0.01. ( I ) The PC levels in NC and si CERKL groups. *, P < 0.05.

    Article Snippet: Human RPE-1 cells (American Type Culture Collection; CRL-4000) were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Gibco 11330057; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS).

    Techniques: Western Blot, Expressing, Knockdown, Real-time Polymerase Chain Reaction, Staining, Immunostaining, Infection, Control, Software, Transfection, Over Expression

    PC supplementation alleviates LD accumulation in CERKL-deficient RPE-1 cells. BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with siCERKL and its corresponding control followed by PC treatment. Scale bars = 10 µm.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: PCYT1A Hypophosphorylation Underlies Retinal Lipid Dysregulation in CERKL Retinitis Pigmentosa and Is Therapeutically Reversed by Phosphatidylcholine

    doi: 10.1167/iovs.67.4.54

    Figure Lengend Snippet: PC supplementation alleviates LD accumulation in CERKL-deficient RPE-1 cells. BODIPY staining and Perilipin-2 immunostaining in RPE-1 cells after infection with siCERKL and its corresponding control followed by PC treatment. Scale bars = 10 µm.

    Article Snippet: Human RPE-1 cells (American Type Culture Collection; CRL-4000) were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Gibco 11330057; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS).

    Techniques: Staining, Immunostaining, Infection, Control

    Depletion of CERKL decreased serine phosphorylation of PCYT1A. ( A ) Workflow of the phosphoproteomic analysis from WT and cerkl −/− zebrafish retinas. ( B ) Protein domain analysis for phosphoproteins with changed phosphorylation level. ( C ) Quantitative analysis of Pcyt1aa sites relative phosphorylation level. ( D ) Alignment of amino acid sequence of PCYT1A between human and zebrafish. ( E ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with flag-tagged PCYT1A or PCYT1A mutants. Scale bars = 10 µm. ( F ) Quantitative analysis of the cells is shown in E . At least 30 cells were quantified per group. ( G ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with flag-tagged PCYT1A or PCYT1A mutants. Scale bars = 10 µm. ( H ) Quantitative analysis of the cells is shown in G . At least 30 cells were quantified per group. The results are shown as mean ± SD. ***, P < 0.001.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: PCYT1A Hypophosphorylation Underlies Retinal Lipid Dysregulation in CERKL Retinitis Pigmentosa and Is Therapeutically Reversed by Phosphatidylcholine

    doi: 10.1167/iovs.67.4.54

    Figure Lengend Snippet: Depletion of CERKL decreased serine phosphorylation of PCYT1A. ( A ) Workflow of the phosphoproteomic analysis from WT and cerkl −/− zebrafish retinas. ( B ) Protein domain analysis for phosphoproteins with changed phosphorylation level. ( C ) Quantitative analysis of Pcyt1aa sites relative phosphorylation level. ( D ) Alignment of amino acid sequence of PCYT1A between human and zebrafish. ( E ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with flag-tagged PCYT1A or PCYT1A mutants. Scale bars = 10 µm. ( F ) Quantitative analysis of the cells is shown in E . At least 30 cells were quantified per group. ( G ) Nile red staining in RPE-1 cells after NC and si CERKL transfection with flag-tagged PCYT1A or PCYT1A mutants. Scale bars = 10 µm. ( H ) Quantitative analysis of the cells is shown in G . At least 30 cells were quantified per group. The results are shown as mean ± SD. ***, P < 0.001.

    Article Snippet: Human RPE-1 cells (American Type Culture Collection; CRL-4000) were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Gibco 11330057; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS).

    Techniques: Phospho-proteomics, Sequencing, Staining, Transfection